Morpholino

MO1-tm6sf2b

ID
ZDB-MRPHLNO-170719-2
Name
MO1-tm6sf2b
Previous Names
  • MO1-tm6sf2
  • tm6sf2_e4 (1)
Target
Sequence
5' - CCTCATGTCATTACGCTAACCGTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tm6sf2b
Phenotype
Phenotype resulting from MO1-tm6sf2b
Phenotype Fish Figures
enterocyte endoplasmic reticulum lumen increased width, abnormal WT + MO1-tm6sf2b Fig. 6 from O'Hare et al., 2017
enterocyte lipid droplet increased amount, abnormal WT + MO1-tm6sf2b Fig. 6 from O'Hare et al., 2017
intestine fatty, abnormal WT + MO1-tm6sf2b Fig. 6 from O'Hare et al., 2017
liver fatty, abnormal WT + MO1-tm6sf2b Fig. 2Fig. 5Fig. S3 from O'Hare et al., 2017
liver ddit3 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 3 from O'Hare et al., 2017
liver edem1 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 3 from O'Hare et al., 2017
liver xbp1 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 3 from O'Hare et al., 2017
liver hspa5 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 3 from O'Hare et al., 2017
liver endoplasmic reticulum lumen dilated, abnormal WT + MO1-tm6sf2b Fig. S6 from O'Hare et al., 2017
liver endoplasmic reticulum lumen increased width, abnormal WT + MO1-tm6sf2b Fig. S6 from O'Hare et al., 2017
liver lipid droplet increased amount, abnormal WT + MO1-tm6sf2b Fig. 2Fig. 3Fig. 5 from O'Hare et al., 2017
whole organism xbp1 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 5 from O'Hare et al., 2017
whole organism edem1 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 5 from O'Hare et al., 2017
whole organism ddit3 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 5 from O'Hare et al., 2017
whole organism hspa5 expression increased amount, abnormal WT + MO1-tm6sf2b Fig. 5 from O'Hare et al., 2017
whole organism low-density lipoprotein particle decreased amount, abnormal WT + MO1-tm6sf2b Fig. 2 from O'Hare et al., 2017
Phenotype of all Fish created by or utilizing MO1-tm6sf2b
Phenotype Fish Conditions Figures
enterocyte lipid droplet increased amount, abnormal WT + MO1-tm6sf2b high fat Fig. 7 from O'Hare et al., 2017
liver hspa5 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 3 from O'Hare et al., 2017
liver endoplasmic reticulum lumen increased width, abnormal WT + MO1-tm6sf2b standard conditions Fig. S6 from O'Hare et al., 2017
whole organism ddit3 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
whole organism low-density lipoprotein particle decreased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 2 from O'Hare et al., 2017
liver fatty, abnormal WT + MO1-tm6sf2b standard conditions Fig. 2Fig. 5Fig. S3 from O'Hare et al., 2017
whole organism xbp1 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
liver edem1 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 3 from O'Hare et al., 2017
whole organism edem1 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
enterocyte endoplasmic reticulum lumen increased width, abnormal WT + MO1-tm6sf2b standard conditions Fig. 6 from O'Hare et al., 2017
intestine fatty, abnormal WT + MO1-tm6sf2b standard conditions Fig. 6 from O'Hare et al., 2017
liver ddit3 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 3 from O'Hare et al., 2017
whole organism hspa5 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
liver xbp1 expression increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 3 from O'Hare et al., 2017
liver lipid droplet increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 2Fig. 3Fig. 5 from O'Hare et al., 2017
intestine lipid homeostasis disrupted, abnormal WT + MO1-tm6sf2b high fat Fig. 7 from O'Hare et al., 2017
liver endoplasmic reticulum lumen dilated, abnormal WT + MO1-tm6sf2b standard conditions Fig. S6 from O'Hare et al., 2017
enterocyte lipid droplet increased amount, abnormal WT + MO1-tm6sf2b standard conditions Fig. 6 from O'Hare et al., 2017
liver fatty, abnormal trappc11hi1532bTg/hi1532bTg + MO1-tm6sf2b standard conditions Fig. 4 from O'Hare et al., 2017
whole organism edem1 expression amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
liver lipid droplet amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
liver morphology, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
whole organism xbp1 expression amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
whole organism ddit3 expression amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
whole organism hspa5 expression amount, ameliorated WT + MO1-dgat2 + MO1-tm6sf2b standard conditions Fig. 5 from O'Hare et al., 2017
Citations