Morpholino

MO1-hsd17b4

ID
ZDB-MRPHLNO-160907-3
Name
MO1-hsd17b4
Previous Names
None
Target
Sequence
5' - TCGGTGATGAAGAACTGACCTCCGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hsd17b4
Phenotype
Phenotype resulting from MO1-hsd17b4
Phenotype Fish Figures
branching involved in blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-hsd17b4 Fig. 4 with image from Kim et al., 2014
embryo development disrupted, abnormal WT + MO1-hsd17b4 Fig. 2 with image from Kim et al., 2014
head decreased size, abnormal WT + MO1-hsd17b4 Fig. 2 with image from Kim et al., 2014
lipid homeostasis disrupted, abnormal WT + MO1-hsd17b4 Fig. 3 with image from Kim et al., 2014
liver decreased size, abnormal gz15Tg + MO1-hsd17b4 Fig. 4 with image from Kim et al., 2014
motor neuron axon development disrupted, abnormal ck1Tg + MO1-hsd17b4 Fig. 3 with image from Kim et al., 2014
motor neuron axonogenesis disrupted, abnormal ck1Tg + MO1-hsd17b4 Fig. 3 with image from Kim et al., 2014
nucleate erythrocyte decreased amount, abnormal ko05Tg + MO1-hsd17b4 Fig. 4 with image from Kim et al., 2014
pancreas absent, abnormal gz15Tg + MO1-hsd17b4 Fig. 4 with image from Kim et al., 2014
pericardium edematous, abnormal WT + MO1-hsd17b4 Fig. 2 with image from Kim et al., 2014
terminal Schwann cell EGFP expression decreased amount, abnormal ck1Tg + MO1-hsd17b4 Fig. 3 with image from Kim et al., 2014
trunk curved, abnormal WT + MO1-hsd17b4 Fig. 2 with image from Kim et al., 2014
whole organism ppargc1a expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism esrra expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism pparab expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism gnpat2 expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism pex5 expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism agps expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
yolk increased size, abnormal WT + MO1-hsd17b4 Fig. 2 with imageFig. 3 with image from Kim et al., 2014
Phenotype of all Fish created by or utilizing MO1-hsd17b4
Phenotype Fish Conditions Figures
whole organism pparab expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
trunk curved, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image from Kim et al., 2014
whole organism agps expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
embryo development disrupted, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image from Kim et al., 2014
whole organism pex5 expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
head decreased size, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image from Kim et al., 2014
whole organism ppargc1a expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
lipid homeostasis disrupted, abnormal WT + MO1-hsd17b4 standard conditions Fig. 3 with image from Kim et al., 2014
yolk increased size, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with imageFig. 3 with image from Kim et al., 2014
pericardium edematous, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image from Kim et al., 2014
whole organism esrra expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
whole organism gnpat2 expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
motor neuron axonogenesis disrupted, abnormal ck1Tg + MO1-hsd17b4 standard conditions Fig. 3 with image from Kim et al., 2014
motor neuron axon development disrupted, abnormal ck1Tg + MO1-hsd17b4 standard conditions Fig. 3 with image from Kim et al., 2014
terminal Schwann cell EGFP expression decreased amount, abnormal ck1Tg + MO1-hsd17b4 standard conditions Fig. 3 with image from Kim et al., 2014
pancreas absent, abnormal gz15Tg + MO1-hsd17b4 standard conditions Fig. 4 with image from Kim et al., 2014
liver decreased size, abnormal gz15Tg + MO1-hsd17b4 standard conditions Fig. 4 with image from Kim et al., 2014
nucleate erythrocyte decreased amount, abnormal ko05Tg + MO1-hsd17b4 standard conditions Fig. 4 with image from Kim et al., 2014
branching involved in blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-hsd17b4 standard conditions Fig. 4 with image from Kim et al., 2014
Citations