Morpholino

MO2-chd7

ID
ZDB-MRPHLNO-111012-2
Name
MO2-chd7
Previous Names
None
Target
Sequence
5' - TTATTTTCTGGCACTAACCATGTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-chd7
Phenotype
Phenotype resulting from MO2-chd7
Phenotype Fish Figures
brain morphology, abnormal AB + MO2-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
caudal fin morphology, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
caudal hematopoietic tissue EGFP expression increased amount, abnormal hkz04tTg + MO2-chd7 Fig. S3 from Liu et al., 2018
caudal hematopoietic tissue myb expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell myb expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell ikzf1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue lymphoid progenitor cell EGFP expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue lymphoid progenitor cell increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage mfap4.1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage EGFP expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue myeloid lineage restricted progenitor cell increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue neutrophil DsRed2 expression increased amount, abnormal nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue neutrophil increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue neutrophil mpx expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue pro-T cell increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue pro-T cell irf4a expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
cranial cartilage malformed, abnormal AB + MO2-chd7 Fig. S2 from Liu et al., 2018
eye decreased size, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
eye morphology, abnormal AB + MO2-chd7 Fig. S2 from Liu et al., 2018
head flattened, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
heart morphology, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
heart looping disrupted, abnormal AB + MO2-chd7 Fig. S2 from Liu et al., 2018
otic vesicle lacks parts or has fewer parts of type otolith, abnormal WT + MO2-chd7 Fig. 2 with image from Balasubramanian et al., 2014
otolith amount, abnormal AB + MO2-chd7 Fig. S2 from Liu et al., 2018
otolith decreased size, abnormal WT + MO2-chd7 Fig. 2 with image from Balasubramanian et al., 2014
otolith fused with otolith, abnormal WT + MO2-chd7 Fig. 2 with image from Balasubramanian et al., 2014
otolith development process quality, abnormal WT + MO2-chd7 Fig. 2 with image from Balasubramanian et al., 2014
pericardium edematous, abnormal AB + MO2-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal arch neural crest cell hand2 expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal arch 4 dlx2a expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal arch 4 hand2 expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal arch 5 hand2 expression decreased amount, abnormal AB + MO2-chd7 Fig. 4 from Liu et al., 2018
pharyngeal pouch zn-5 labeling decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharyngeal pouch 2 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharyngeal pouch 3 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharyngeal pouch 4 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharyngeal pouch 5 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharynx bmp4 expression decreased amount, abnormal AB + MO2-chd7 Fig. 8 from Liu et al., 2018
pharynx bmp2b expression decreased amount, abnormal AB + MO2-chd7 Fig. 8 from Liu et al., 2018
pharynx hypotrophic, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
pharynx cell population proliferation decreased process quality, abnormal AB + MO2-chd7 Fig. 6 from Liu et al., 2018
T cell migration decreased process quality, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 5 from Liu et al., 2018
thymus foxn1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
thymus GFP expression decreased amount, abnormal zdf8Tg + MO2-chd7 Fig. 1Fig. 7 from Liu et al., 2018
thymus myb expression decreased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
thymus EGFP expression decreased amount, abnormal hkz04tTg + MO2-chd7 Fig. 6Fig. S3 from Liu et al., 2018
thymus rag1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 7 from Liu et al., 2018
thymus apoptotic process increased process quality, abnormal AB + MO2-chd7 Fig. 6 from Liu et al., 2018
thymus cell population proliferation decreased process quality, abnormal AB + MO2-chd7 Fig. 6 from Liu et al., 2018
thymus T cell ikzf1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
thymus T cell decreased amount, abnormal zdf8Tg + MO2-chd7 Fig. 1Fig. 2 from Liu et al., 2018
thymus T cell rag1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
thymus T cell il7r expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
thymus epithelium morphogenesis disrupted, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
thymus primordium ccl25a expression decreased amount, abnormal AB + MO2-chd7 Fig. 5 from Liu et al., 2018
thymus primordium ccl25b expression decreased amount, abnormal AB + MO2-chd7 Fig. 5 from Liu et al., 2018
thymus primordium lymphoid progenitor cell EGFP expression decreased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 Fig. 5 from Liu et al., 2018
thymus primordium lymphoid progenitor cell decreased amount, abnormal AB + MO2-chd7 Fig. 2Fig. 5 from Liu et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell myb expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell ikzf1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism il7r expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
whole organism rag2 expression decreased amount, abnormal AB + MO2-chd7 Fig. 7 from Liu et al., 2018
whole organism rag1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 1Fig. 7 from Liu et al., 2018
whole organism ikzf1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 1 from Liu et al., 2018
whole organism ccl25a expression decreased amount, abnormal AB + MO2-chd7 Fig. 5 from Liu et al., 2018
whole organism ccl25b expression decreased amount, abnormal AB + MO2-chd7 Fig. 5 from Liu et al., 2018
whole organism foxn1 expression decreased amount, abnormal AB + MO2-chd7 Fig. 3 from Liu et al., 2018
whole organism ikzf1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism myb expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism mfap4.1 expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism mpx expression increased amount, abnormal AB + MO2-chd7 Fig. 2 from Liu et al., 2018
whole organism anterior-posterior axis curved, abnormal AB + MO2-chd7 Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
whole organism anterior-posterior axis kinked, abnormal AB + MO2-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
Phenotype of all Fish created by or utilizing MO2-chd7
Phenotype Fish Conditions Figures
pharynx hypotrophic, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
pharynx bmp2b expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 8 from Liu et al., 2018
pharyngeal arch 4 dlx2a expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell ikzf1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal pouch 2 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
thymus apoptotic process increased process quality, abnormal AB + MO2-chd7 standard conditions Fig. 6 from Liu et al., 2018
caudal fin morphology, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
pharynx cell population proliferation decreased process quality, abnormal AB + MO2-chd7 standard conditions Fig. 6 from Liu et al., 2018
caudal hematopoietic tissue neutrophil mpx expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus foxn1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
heart morphology, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
thymus T cell rag1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
whole organism ikzf1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal arch neural crest cell hand2 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
thymus primordium ccl25a expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell ikzf1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
whole organism mfap4.1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus epithelium morphogenesis disrupted, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
caudal hematopoietic tissue myeloid lineage restricted progenitor cell increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal arch 4 hand2 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
caudal hematopoietic tissue pro-T cell irf4a expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus T cell decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1Fig. 2 from Liu et al., 2018
thymus cell population proliferation decreased process quality, abnormal AB + MO2-chd7 standard conditions Fig. 6 from Liu et al., 2018
thymus T cell il7r expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
pharyngeal pouch 4 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
otolith amount, abnormal AB + MO2-chd7 standard conditions Fig. S2 from Liu et al., 2018
head flattened, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
caudal hematopoietic tissue neutrophil increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
heart looping disrupted, abnormal AB + MO2-chd7 standard conditions Fig. S2 from Liu et al., 2018
cranial cartilage malformed, abnormal AB + MO2-chd7 standard conditions Fig. S2 from Liu et al., 2018
whole organism anterior-posterior axis curved, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
caudal hematopoietic tissue myb expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
whole organism il7r expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
pharyngeal pouch 5 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
whole organism ccl25b expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell myb expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
eye morphology, abnormal AB + MO2-chd7 standard conditions Fig. S2 from Liu et al., 2018
thymus primordium ccl25b expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
whole organism ikzf1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
eye decreased size, abnormal AB + MO2-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
whole organism mpx expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
whole organism rag1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1Fig. 7 from Liu et al., 2018
thymus myb expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal arch 5 hand2 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 4 from Liu et al., 2018
brain morphology, abnormal AB + MO2-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
whole organism ccl25a expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
caudal hematopoietic tissue macrophage mfap4.1 expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue hematopoietic stem cell myb expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus primordium lymphoid progenitor cell decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
pharyngeal pouch zn-5 labeling decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
whole organism rag2 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 7 from Liu et al., 2018
pharynx bmp4 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 8 from Liu et al., 2018
thymus T cell ikzf1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
caudal hematopoietic tissue pro-T cell increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
whole organism foxn1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
pharyngeal pouch 3 nkx2.3 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 3 from Liu et al., 2018
whole organism anterior-posterior axis kinked, abnormal AB + MO2-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
whole organism myb expression increased amount, abnormal AB + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus rag1 expression decreased amount, abnormal AB + MO2-chd7 standard conditions Fig. 7 from Liu et al., 2018
pericardium edematous, abnormal AB + MO2-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
otolith decreased size, abnormal WT + MO2-chd7 standard conditions Fig. 2 with image from Balasubramanian et al., 2014
otic vesicle lacks parts or has fewer parts of type otolith, abnormal WT + MO2-chd7 standard conditions Fig. 2 with image from Balasubramanian et al., 2014
otolith fused with otolith, abnormal WT + MO2-chd7 standard conditions Fig. 2 with image from Balasubramanian et al., 2014
otolith development process quality, abnormal WT + MO2-chd7 standard conditions Fig. 2 with image from Balasubramanian et al., 2014
caudal hematopoietic tissue EGFP expression increased amount, abnormal hkz04tTg + MO2-chd7 standard conditions Fig. S3 from Liu et al., 2018
thymus EGFP expression decreased amount, abnormal hkz04tTg + MO2-chd7 standard conditions Fig. 6Fig. S3 from Liu et al., 2018
thymus apoptotic process increased process quality, abnormal hkz04tTg + MO2-chd7 standard conditions Fig. 6 from Liu et al., 2018
caudal hematopoietic tissue neutrophil increased amount, abnormal nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue neutrophil DsRed2 expression increased amount, abnormal nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus T cell decreased amount, abnormal zdf8Tg + MO2-chd7 standard conditions Fig. 1 from Liu et al., 2018
thymus GFP expression decreased amount, abnormal zdf8Tg + MO2-chd7 standard conditions Fig. 1Fig. 7 from Liu et al., 2018
caudal hematopoietic tissue neutrophil increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus primordium lymphoid progenitor cell EGFP expression decreased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
caudal hematopoietic tissue lymphoid progenitor cell EGFP expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue macrophage EGFP expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
caudal hematopoietic tissue lymphoid progenitor cell increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
T cell migration decreased process quality, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
caudal hematopoietic tissue neutrophil DsRed2 expression increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
thymus primordium lymphoid progenitor cell decreased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 5 from Liu et al., 2018
caudal hematopoietic tissue macrophage increased amount, abnormal hkz04tTg; nz50Tg + MO2-chd7 standard conditions Fig. 2 from Liu et al., 2018
Citations