Morpholino

MO3-rack1

ID

ZDB-MRPHLNO-110222-3

Name

MO3-rack1

Previous Names

Target

Sequence

5' - CCCTTACTGTCATCTGCTCGGTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-rack1

Expressed Gene	Anatomy	Figures
rack1	(not) whole organism	Fig. 2 from Li et al., 2011

Phenotype

Phenotype resulting from MO3-rack1

Phenotype	Fish	Figures
convergent extension involved in gastrulation disrupted, abnormal	WT + MO3-rack1	Fig. 4 from Li et al., 2011
establishment of cell polarity disrupted, abnormal	WT + MO3-rack1	Fig. 3 from Li et al., 2011
establishment of mitotic spindle orientation disrupted, abnormal	WT + MO3-rack1	Fig. 3 from Li et al., 2011
notochord increased width, abnormal	WT + MO3-rack1	Fig. 3 from Li et al., 2011
notochord undulate, abnormal	WT + MO3-rack1	Fig. 2 , Fig. 3 from Li et al., 2011
somite increased width, abnormal	WT + MO3-rack1	Fig. 2 from Li et al., 2011
whole organism decreased length, abnormal	WT + MO3-rack1	Fig. 2 from Li et al., 2011

Phenotype of all Fish created by or utilizing MO3-rack1

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	WT + MO3-rack1	standard conditions	Fig. 2 from Li et al., 2011
notochord increased width, abnormal	WT + MO3-rack1	standard conditions	Fig. 3 from Li et al., 2011
establishment of cell polarity disrupted, abnormal	WT + MO3-rack1	standard conditions	Fig. 3 from Li et al., 2011
establishment of mitotic spindle orientation disrupted, abnormal	WT + MO3-rack1	standard conditions	Fig. 3 from Li et al., 2011
somite increased width, abnormal	WT + MO3-rack1	standard conditions	Fig. 2 from Li et al., 2011
convergent extension involved in gastrulation disrupted, abnormal	WT + MO3-rack1	standard conditions	Fig. 4 from Li et al., 2011
notochord undulate, abnormal	WT + MO3-rack1	standard conditions	Fig. 2 , Fig. 3 from Li et al., 2011
somite increased width, abnormal	WT + MO1-vangl2 + MO3-rack1	standard conditions	Fig. 2 from Li et al., 2011
notochord undulate, abnormal	WT + MO1-vangl2 + MO3-rack1	standard conditions	Fig. 2 from Li et al., 2011
whole organism decreased length, abnormal	WT + MO1-vangl2 + MO3-rack1	standard conditions	Fig. 2 from Li et al., 2011

Citations