Morpholino

MO1-mkks

ID
ZDB-MRPHLNO-060126-1
Name
MO1-mkks
Previous Names
None
Target
Sequence
5' - GCTTCTTCTTACTAATGCGAGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mkks
Phenotype
Phenotype resulting from MO1-mkks
Phenotype Fish Figures
cell migration involved in gastrulation disrupted, abnormal WT + MO1-mkks Fig. S3 with image from Zaghloul et al., 2010
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-mkks Fig. 1 from Gerdes et al., 2007
gastrulation disrupted, abnormal WT + MO1-mkks Fig. S4 with image from Zaghloul et al., 2010
kidney edematous, abnormal WT + MO1-mkks Fig. 1 with image from Tobin et al., 2008
Kupffer's vesicle cilium decreased amount, abnormal TU + MO1-mkks Figure S1 from Castro-Sánchez et al., 2019
Kupffer's vesicle cilium decreased length, abnormal TU + MO1-mkks Figure 7 with image from Castro-Sánchez et al., 2019
Kupffer's vesicle cilium spatial pattern, abnormal TU + MO1-mkks Figure 7 with image from Castro-Sánchez et al., 2019
mandibular arch skeleton decreased size, abnormal WT + MO1-mkks Fig. 2 with image from Tobin et al., 2008
neurocranium decreased size, abnormal WT + MO1-mkks Fig. 2 with image from Tobin et al., 2008
notochord increased width, abnormal TU + MO1-mkks Figure 4 with image from Castro-Sánchez et al., 2019
Fig. 1 from Gerdes et al., 2007
Fig. S4Fig. S5Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-mkks Figure 4 with image from Castro-Sánchez et al., 2019
Fig. S4 with image from Zaghloul et al., 2010
Fig. 1 from Gerdes et al., 2007
Fig. S4Fig. S5Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
pharyngeal arch 3-7 decreased size, abnormal WT + MO1-mkks Fig. 2 with image from Tobin et al., 2008
post-vent region morphology, abnormal WT + MO1-mkks Fig. S4Fig. S7 from Badano et al., 2006
somite amorphous, abnormal WT + MO1-mkks Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-mkks Fig. 1 from Gerdes et al., 2007
Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-mkks Fig. S4 with image from Zaghloul et al., 2010
Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
somite morphology, abnormal TU + MO1-mkks Figure 4 with image from Castro-Sánchez et al., 2019
somite shape, abnormal WT + MO1-mkks Fig. 1 from Gerdes et al., 2007
Fig. S4Fig. S5 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-mkks Fig. S4Fig. S7 from Badano et al., 2006
whole organism decreased length, abnormal WT + MO1-mkks Fig. 1 from Gerdes et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkks Figure 4 with image from Castro-Sánchez et al., 2019
Fig. S4 with image from Zaghloul et al., 2010
Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
Phenotype of all Fish created by or utilizing MO1-mkks
Phenotype Fish Conditions Figures
somite morphology, abnormal TU + MO1-mkks standard conditions Figure 4 with image from Castro-Sánchez et al., 2019
Kupffer's vesicle cilium decreased amount, abnormal TU + MO1-mkks standard conditions Figure S1 from Castro-Sánchez et al., 2019
whole organism anterior-posterior axis decreased length, abnormal TU + MO1-mkks standard conditions Figure 4 with image from Castro-Sánchez et al., 2019
Kupffer's vesicle cilium decreased length, abnormal TU + MO1-mkks standard conditions Figure 7 with image from Castro-Sánchez et al., 2019
Kupffer's vesicle cilium spatial pattern, abnormal TU + MO1-mkks standard conditions Figure 7 with image from Castro-Sánchez et al., 2019
notochord kinked, abnormal TU + MO1-mkks standard conditions Figure 4 with image from Castro-Sánchez et al., 2019
notochord increased width, abnormal TU + MO1-mkks standard conditions Figure 4 with image from Castro-Sánchez et al., 2019
somite shape, abnormal WT + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
Fig. S4Fig. S5 from Badano et al., 2006
somite increased length, abnormal WT + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
Fig. 2 from Stoetzel et al., 2006
kidney edematous, abnormal WT + MO1-mkks standard conditions Fig. 1 with image from Tobin et al., 2008
mandibular arch skeleton decreased size, abnormal WT + MO1-mkks standard conditions Fig. 2 with image from Tobin et al., 2008
notochord kinked, abnormal WT + MO1-mkks standard conditions Fig. S4 with image from Zaghloul et al., 2010
Fig. 1 from Gerdes et al., 2007
Fig. S4Fig. S5Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
neurocranium decreased size, abnormal WT + MO1-mkks standard conditions Fig. 2 with image from Tobin et al., 2008
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
cell migration involved in gastrulation disrupted, abnormal WT + MO1-mkks standard conditions Fig. S3 with image from Zaghloul et al., 2010
whole organism decreased length, abnormal WT + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkks standard conditions Fig. S4 with image from Zaghloul et al., 2010
Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
notochord increased width, abnormal WT + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
Fig. S4Fig. S5Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
gastrulation disrupted, abnormal WT + MO1-mkks standard conditions Fig. S4 with image from Zaghloul et al., 2010
post-vent region morphology, abnormal WT + MO1-mkks standard conditions Fig. S4Fig. S7 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-mkks standard conditions Fig. S4Fig. S7 from Badano et al., 2006
somite increased width, abnormal WT + MO1-mkks standard conditions Fig. S4 with image from Zaghloul et al., 2010
Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
pharyngeal arch 3-7 decreased size, abnormal WT + MO1-mkks standard conditions Fig. 2 with image from Tobin et al., 2008
neural rod increased width, abnormal vangl2m209/m209 + MO1-mkks standard conditions text only from Ross et al., 2005
presumptive rhombomere 5 decreased distance somite 1, abnormal vangl2m209/m209 + MO1-mkks standard conditions text only from Ross et al., 2005
somite antero-posteriorly flattened, abnormal vangl2m209/m209 + MO1-mkks standard conditions text only from Ross et al., 2005
whole organism anterior-posterior axis decreased length, abnormal vangl2m209/m209 + MO1-mkks standard conditions Fig. 5text only from Ross et al., 2005
convergent extension involved in axis elongation disrupted, abnormal wnt5bta98/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
notochord kinked, abnormal wnt5bta98/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
somite shape, abnormal wnt5bta98/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
somite increased length, abnormal wnt5bta98/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
whole organism decreased length, abnormal wnt5bta98/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
notochord increased width, abnormal wnt5bta98/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
convergent extension involved in axis elongation disrupted, abnormal wnt11f2tx226/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
notochord kinked, abnormal wnt11f2tx226/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
somite shape, abnormal wnt11f2tx226/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
notochord increased width, abnormal wnt11f2tx226/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
whole organism decreased length, abnormal wnt11f2tx226/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
somite increased length, abnormal wnt11f2tx226/+ + MO1-mkks standard conditions Fig. 1 from Gerdes et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
notochord increased width, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
somite border amorphous, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
notochord increased width, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
post-vent region morphology, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
somite increased width, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
notochord kinked, abnormal WT + MO1-ccdc28b + MO1-mkks standard conditions Fig. S7 from Badano et al., 2006
Citations