Morpholino

MO1-tbxta

ID
ZDB-MRPHLNO-050221-3
Name
MO1-tbxta
Previous Names
  • MO1-ntl
  • MO1-ta
  • ntl MO (1)
  • ntl-MO (1)
Target
Sequence
5' - GACTTGAGGCAGGCATATTTCCGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Characterized by a normal head, abnormal somites and a reduced tail.
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbxta
Expressed Gene Anatomy Figures
dand5 Fig. 1 with imageFig. 2 with imageFig. 3 with image from Gourronc et al., 2007
enc3 Fig. 4 with image from Qian et al., 2013
fgf3 Fig. 4 with image from Osborn et al., 2020
fgf4 Fig. 4 with image from Osborn et al., 2020
fgf8a Fig. 4 with image from Osborn et al., 2020
lft1 Fig. 3 from Amack et al., 2004
lft2 Fig. 3 from Amack et al., 2004
myf5 Fig. 4 with image from Osborn et al., 2020
myod1 Fig. 4 with image from Osborn et al., 2020
nphs1 Fig. 8 with image from Huang et al., 2013
nphs2 Fig. 8 with image from Huang et al., 2013
pdia6 Fig. 2 with image from Gourronc et al., 2007
pitx2 Fig. 4 from Burdine et al., 2016
shha Fig. 2 with image from Gourronc et al., 2007
slc20a1a Fig. 8 with image from Huang et al., 2013
sox17 text only from Amack et al., 2007
spaw Fig. 4 with image from Pelliccia et al., 2017
Fig. 2 with image from Gourronc et al., 2007
tbx16 Fig. 6 with image from Amack et al., 2007
tbxta Fig. 6 with image from Amack et al., 2007
Fig. 2 with imageFig. 3 with image from Gourronc et al., 2007
Fig. 2 from Amack et al., 2004
Phenotype
Phenotype resulting from MO1-tbxta
Phenotype Fish Figures
axial chorda mesoderm fgf8a expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO1-tbxta Fig. 7 with image from Francescatto et al., 2010
determination of digestive tract left/right asymmetry decreased process quality, abnormal pd24Tg + MO1-tbxta Fig. 6 with image from Hochgreb-Hägele et al., 2013
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-tbxta Fig. 2 with image from Hatler et al., 2009
embryonic heart tube left/right pattern formation process quality, abnormal twu34Tg + MO1-tbxta Fig. 1 with image from Lenhart et al., 2013
epithalamus determination of left/right symmetry disrupted, abnormal WT + MO1-tbxta Fig. T1 with image from Roussigné et al., 2009
habenula determination of left/right symmetry disrupted, abnormal WT + MO1-tbxta Fig. 5 with image from Roussigné et al., 2009
habenula neurogenesis process quality, abnormal WT + MO1-tbxta Fig. 5 with image from Roussigné et al., 2009
heart looping disrupted, abnormal WT + MO1-tbxta Fig. 2 with image from Hatler et al., 2009
heart rudiment cardioblast anterior-lateral migration process quality, abnormal twu34Tg + MO1-tbxta Fig. 1 with image from Lenhart et al., 2013
heart tube mislocalised radially, abnormal WT + MO1-tbxta Fig. 2 with image from Hatler et al., 2009
Kupffer's vesicle unlumenized, abnormal AB + MO1-tbxta Fig. 7 with image from Amack et al., 2007
lateral mesoderm morphogenesis decreased process quality, abnormal pd24Tg + MO1-tbxta Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm bilateral symmetry, abnormal pd24Tg + MO1-tbxta Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm mislocalised, abnormal pd24Tg + MO1-tbxta Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-tbxta Fig. 4 with image from Pelliccia et al., 2017
margin fgf8a expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
nodal signaling pathway disrupted, abnormal WT + MO1-tbxta Fig. 5 with image from Roussigné et al., 2009
notochord posterior-most region fgf3 expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf4 expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
notochord posterior-most region fgf8a expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
post-vent region aplastic, abnormal WT + MO1-tbxta + MO4-tp53 Fig. 5 with image from Robu et al., 2007
post-vent region shape, abnormal AB + MO1-tbxta Fig. 8 with image from Amack et al., 2007
presumptive paraxial mesoderm myod1 expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
protein autophosphorylation arrested, abnormal WT + MO1-tbxta Fig. 7 with image from Francescatto et al., 2010
segmental plate adaxial cell myod1 expression absent, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myf5 expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
somite adaxial cell myod1 expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
tail bud myf5 expression decreased distribution, abnormal WT + MO1-tbxta Fig. 4 with image from Osborn et al., 2020
trunk morphology, abnormal AB + MO1-tbxta Fig. 8 with image from Amack et al., 2007
whole organism decreased length, abnormal WT + MO1-tbxta Fig. 4 from Burdine et al., 2016
Phenotype of all Fish created by or utilizing MO1-tbxta
Phenotype Fish Conditions Figures
post-vent region shape, abnormal AB + MO1-tbxta standard conditions Fig. 8 with image from Amack et al., 2007
Kupffer's vesicle unlumenized, abnormal AB + MO1-tbxta standard conditions Fig. 7 with image from Amack et al., 2007
trunk morphology, abnormal AB + MO1-tbxta standard conditions Fig. 8 with image from Amack et al., 2007
nodal signaling pathway disrupted, abnormal WT + MO1-tbxta standard conditions Fig. 5 with image from Roussigné et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-tbxta standard conditions Fig. 2 with image from Hatler et al., 2009
segmental plate adaxial cell myf5 expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
tail bud myf5 expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
whole organism decreased length, abnormal WT + MO1-tbxta standard conditions Fig. 4 from Burdine et al., 2016
tail bud myod1 expression absent, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
somite adaxial cell myod1 expression absent, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
tail bud myf5 expression increased amount, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
habenula determination of left/right symmetry disrupted, abnormal WT + MO1-tbxta standard conditions Fig. 5 with image from Roussigné et al., 2009
notochord posterior-most region fgf4 expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
protein autophosphorylation arrested, abnormal WT + MO1-tbxta standard conditions Fig. 7 with image from Francescatto et al., 2010
calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO1-tbxta standard conditions Fig. 7 with image from Francescatto et al., 2010
heart looping disrupted, abnormal WT + MO1-tbxta standard conditions Fig. 2 with image from Hatler et al., 2009
epithalamus determination of left/right symmetry disrupted, abnormal WT + MO1-tbxta standard conditions Fig. T1 with image from Roussigné et al., 2009
margin fgf8a expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
adaxial cell myf5 expression decreased distribution, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
segmental plate adaxial cell myod1 expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-tbxta control Fig. 4 with image from Pelliccia et al., 2017
somite adaxial cell myod1 expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
post-vent region aplastic, abnormal WT + MO1-tbxta standard conditions Fig. 5 with image from Robu et al., 2007
segmental plate adaxial cell myod1 expression absent, abnormal WT + MO1-tbxta chemical treatment: Cyclopamine Fig. 4 with image from Osborn et al., 2020
habenula neurogenesis process quality, abnormal WT + MO1-tbxta standard conditions Fig. 5 with image from Roussigné et al., 2009
notochord posterior-most region fgf8a expression decreased distribution, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
heart tube mislocalised radially, abnormal WT + MO1-tbxta standard conditions Fig. 2 with image from Hatler et al., 2009
notochord posterior-most region fgf3 expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
presumptive paraxial mesoderm myod1 expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
axial chorda mesoderm fgf8a expression absent, abnormal WT + MO1-tbxta standard conditions Fig. 4 with image from Osborn et al., 2020
post-vent region aplastic, abnormal WT + MO1-tbxta + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
determination of digestive tract left/right asymmetry decreased process quality, abnormal pd24Tg + MO1-tbxta standard conditions Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral mesoderm morphogenesis decreased process quality, abnormal pd24Tg + MO1-tbxta standard conditions Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm mislocalised, abnormal pd24Tg + MO1-tbxta standard conditions Fig. 6 with image from Hochgreb-Hägele et al., 2013
lateral plate mesoderm bilateral symmetry, abnormal pd24Tg + MO1-tbxta standard conditions Fig. 6 with image from Hochgreb-Hägele et al., 2013
heart rudiment cardioblast anterior-lateral migration process quality, abnormal twu34Tg + MO1-tbxta standard conditions Fig. 1 with image from Lenhart et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal twu34Tg + MO1-tbxta standard conditions Fig. 1 with image from Lenhart et al., 2013
post-vent region shape, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
Kupffer's vesicle ciliated cell absent, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
trunk morphology, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
lateral plate mesoderm spaw expression absent, abnormal WT + MO1-tbxta + MO2-gdf3 control Fig. 4 with image from Pelliccia et al., 2017
Citations